Top » Catalog » SNPs » JFS3042

$18.00

JFS3042
[JFS3042]

JFS3042
hg38 Position: ChrY:12509738..12509738
Ancestral: C
Derived: T
Reference: John Sloan (2018)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U198 > S15627 > Y14069 > Y14201 > BY16497 >JFS0217
Forward Primer: JFS3042_F GGCTAACATCTGTAATCCCAGC
Reverse Primer: JFS3042_R TAGAAATCTCATTAGCAGTTGTTTCC
Reviews

Customers who bought this product also purchased
JFS0217
JFS0217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies