Top » Catalog » SNPs » Y133711

$18.00

Y133711
[Y133711]

Y133711
hg38 Position: ChrY:21237377..21237377
Ancestral: C
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y133711_F TGATTGTGAATGGGAGTTTATTCTG
Reverse Primer: Y133711_R ATATCTCAATATATCCAGAAAATGCCTTC
Reviews

Customers who bought this product also purchased
FGC72518
FGC72518
Y133699
Y133699
R1b Nankivell Group SNP Test
R1b Nankivell Group SNP Test
Y133674
Y133674
Y133685
Y133685
Y133668
Y133668
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies