Top » Catalog » SNPs » FGC63912

$19.00

FGC63912
[FGC63912]

FGC63912
hg38 Position: ChrY:21072524..21072524
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: Below U106
Forward Primer: FGC63912_F TTGTCATCCTTCCACAGGAAC
Reverse Primer: FGC63912_R GGGCAGATGCGTATGTCAC
Reviews

Customers who bought this product also purchased
FGC63898
FGC63898
Y133674
Y133674
FGC63911
FGC63911
FGC63906
FGC63906
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies