Top » Catalog » SNPs » FGC11336

$18.00

FGC11336
[FGC11336]

FGC11336
hg38 Position: ChrY:13756944..13756944
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b
Comments: Downstream L1336
Forward Primer: FGC11336_F ACCCCAAAACTCTGCAAAAC
Reverse Primer: FGC11336_R GGAGCCAAGAAGCACATCTC
Reviews (1)

Customers who bought this product also purchased
FGC11323
FGC11323
FGC11352
FGC11352
FGC11350
FGC11350
FGC11346
FGC11346
FGC11341
FGC11341
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies