Top » Catalog » SNPs » BY30715

$19.00

BY30715
[BY30715]

BY30715
hg38 Position: ChrY:19677296..19677296
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: L1029
Forward Primer: BY30715_F AAACTCTCAATCTTCCTAGGAACTACC
Reverse Primer: BY30715_R GGTCTCAAGGAAACTTTTGAATAAGTC
Reviews

Customers who bought this product also purchased
Z282
Z282
M343
M343
P38
P38
M9
M9
Z28000
Z28000
BY182600
BY182600
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies