Top » Catalog » SNPs » FGC20779

$18.00

FGC20779
[FGC20779]

FGC20779
hg38 Position: ChrY:7447714..7447714
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b
Comments: Below FGC20803
Forward Primer: FGC20779_F TCTTGAGGCTACCTCTGGGC
Reverse Primer: FGC20779_R GCAGACACAGTTCCCAGGC
Reviews

Customers who bought this product also purchased
FGC20790
FGC20790
FGC20797
FGC20797
FGC20804
FGC20804
FGC20781
FGC20781
FGC20812
FGC20812
FGC20789
FGC20789
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies