Top » Catalog » SNPs » Y109284

$19.00

Y109284
[Y109284]

Y109284
hg38 Position: ChrY:20454013..20454013
Ancestral: C
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: E1b
Comments: .
Forward Primer: Y109284_F ATTATGCAAGCCCATGTGTG
Reverse Primer: Y109284_R TGCAAGTTGAGGAAGCACAG
Reviews

Customers who bought this product also purchased
FGC86593
FGC86593
FGC86592
FGC86592
FGC63180
FGC63180
Y83795
Y83795
E1b David-2 Goodrich Panel
E1b David-2 Goodrich Panel
Y82249
Y82249
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies