Top » Catalog » SNPs » BY4456

$18.00

BY4456
[BY4456]

BY4456
hg38 Position: ChrY:12552587..12552587
Ancestral: C
Derived: G
Reference: FTDNA (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: BY4456_F TAACACAGGCACCCACTCAG
Reverse Primer: BY4456_R CTTCAAATGTGTGGGCCTTC
Reviews

Customers who bought this product also purchased
BY4464
BY4464
BY4463
BY4463
BY4462
BY4462
BY4455
BY4455
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies