Top » Catalog » SNPs » A22125

$18.00

A22125
[A22125]

A22125
hg38 Position: ChrY:17236450..17236450
Ancestral: T
Derived: A
Reference: Brian Westrupp (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A22125_F CAGTTTGCATGCATTTGGAG
Reverse Primer: A22125_R CTTCTAGCTGGGACCACAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies