Top » Catalog » SNPs » ZS2740

$18.00

ZS2740
[ZS2740]

ZS2740
hg38 Position: ChrY:17277237..17277237
Ancestral: G
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1
Comments: Below ZS2740
Forward Primer: ZS2740_F GGTGCCAATGTGTTCAAATG
Reverse Primer: ZS2740_R CTGGGATCTGAAGGCAAAAG
Reviews

Customers who bought this product also purchased
Y11545
Y11545
Y14282
Y14282
ZS2754
ZS2754
ZS10760
ZS10760
BY8
BY8
ZS1951
ZS1951
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies