Top » Catalog » SNPs » ZS1310

$18.00

ZS1310
[ZS1310]

ZS1310
hg38 Position: ChrY:18931824..18931824
Ancestral: C
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: Found in Big Y sample 279797; approximate to L92.1
Forward Primer: ZS1310_F CACCACACCCTTGATATGGG
Reverse Primer: ZS1310_R AAACCATAACTCATATTTTACCTATAACAATTTG
Reviews

Customers who bought this product also purchased
ZS1313
ZS1313
J1-ZS1282 Panel
J1-ZS1282 Panel
Y144562
Y144562
ZS1283
ZS1283
Y144553
Y144553
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS513
1 x DYS456
$22.00
Haplogroup Info
Other products
Currencies