Top » Catalog » SNPs » A8323

$18.00

A8323
[A8323]

A8323
hg38 Position: ChrY:7831458..7831458
Ancestral: C
Derived: T
Reference: William STEWART (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF41 > S781
Forward Primer: A8323_F AACATAAAACCTTGAGTTCATGTCTTC
Reverse Primer: A8323_R CGGAAGGCAGTTACTCTTCTG
Reviews (1)
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies