Top » Catalog » SNPs » Y133383

$18.00

Y133383
[Y133383]

Y133383
hg38 Position: ChrY:8675420..8675420
Ancestral: T
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: R1a
Comments: Below L1029
Forward Primer: Y133383_F TTCCTTTCCTGTCTTTCATGTTG
Reverse Primer: Y133383_R CAACATTCAAAGATTCTTTTCAGC
Reviews

Customers who bought this product also purchased
Y133380
Y133380
Y133367
Y133367
Y133361
Y133361
Y133354
Y133354
Y133351
Y133351
Y133386
Y133386
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies