Top » Catalog » SNPs » BY35613

$18.00

BY35613
[BY35613]

BY35613
hg38 Position: ChrY:9925928..9925928
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > YP1337
Forward Primer: BY35613_F TTCCTGATTGAGTTTCTGGCTG
Reverse Primer: BY35613_R AGTAACTTACAACTGGATTCCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x mtComplete
1 x mtUpgrade
1 x HVR2
1 x HVR1
1 x YSEQ-Gamma
1 x YSEQ-Beta
1 x YSEQ-Delta
1 x YSEQ-XTD
$603.00
Haplogroup Info
Other products
Currencies