Top » Catalog » SNPs » BY35659

$18.00

BY35659
[BY35659]

BY35659
hg38 Position: ChrY:17178140..17178140
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: Below M458 > YP1337
Forward Primer: BY35659_F TCCAACTGTGGTGAGCTCTG
Reverse Primer: BY35659_R AAATTAAATACCTGAGTGCCAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies