Top » Catalog » SNPs » A1063

$18.00

A1063
[A1063]

A1063
hg38 Position: ChrY:7955894..7955894
Ancestral: C
Derived: T
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1063_F TTCAGCAGTGGTAACCAAACTG
Reverse Primer: A1063_R CAAATAGGAGAAGCCTCTTCTTACAC
Reviews

Customers who bought this product also purchased
A1067
A1067
A1071
A1071
A1064
A1064
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies