Top » Catalog » SNPs » A1064

$18.00

A1064
[A1064]

A1064
hg38 Position: ChrY:7974950..7974950
Ancestral: G
Derived: T
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1064_F TTCTCAATATCTCACAGATCTCCG
Reverse Primer: A1064_R CCACATGGAGCATTGTAACATC
Reviews

Customers who bought this product also purchased
A1071
A1071
A1063
A1063
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies