Top » Catalog » SNPs » A1067

$18.00

A1067
[A1067]

A1067
HG19 Position: ChrY:13026547..13026547
Ancestral: G
Derived: C
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a2a1
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1067_F CACATCATTTTCTTGAATTTGTCC
Reverse Primer: A1067_R AGAAAGTCAGCAGCTTTGCTG
Reviews

Customers who bought this product also purchased
A1075
A1075
A1063
A1063
A1065
A1065
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11513
1 x A10750
1 x A10951
$54.00
Haplogroup Info
Other products
Currencies