Top » Catalog » SNPs » A1069

$18.00

A1069
[A1069]

A1069
HG19 Position: ChrY:14664057..14664057
Ancestral: T
Derived: A
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b1b1a2a
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1069_F ATTCTCCTGCCTCCTGGG
Reverse Primer: A1069_R AAAAGCCATACCAATGGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10680
$18.00
Haplogroup Info
Other products
Currencies