Top » Catalog » SNPs » A1070

$18.00

A1070
[A1070]

A1070
HG19 Position: ChrY:15446730..15446730
Ancestral: A
Derived: T
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1070_F GCTCTCACCTTCATAGACATACTGG
Reverse Primer: A1070_R GCTGGACCATCTGTGTGTTTC
Reviews

Customers who bought this product also purchased
A1068
A1068
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies