Top » Catalog » SNPs » A1071

$17.50

A1071
[A1071]

A1071
HG19 Position: ChrY:23955434..23955434
Ancestral: A
Derived: G
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1071_F TGGGGCATTTACAAACCTTC
Reverse Primer: A1071_R TTGAAAAGGAGTTTACTTCCCAATAG
Reviews

Customers who bought this product also purchased
A1064
A1064
A1063
A1063
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies