Top » Catalog » SNPs » A1071

$18.00

A1071
[A1071]

A1071
HG19 Position: ChrY:21809287..21809287
Ancestral: A
Derived: G
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1071_F TGGGGCATTTACAAACCTTC
Reverse Primer: A1071_R TTGAAAAGGAGTTTACTTCCCAATAG
Reviews

Customers who bought this product also purchased
A1063
A1063
A1064
A1064
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11293
1 x A11619
1 x A10216
1 x A10369
1 x A109
1 x A11502
1 x A11460
1 x A10298
$144.00
Haplogroup Info
Other products
Currencies