Top » Catalog » SNPs » A1073

$18.00

A1073
[A1073]

A1073
HG19 Position: ChrY:17067734..17067734
Ancestral: T
Derived: C
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1073_F TGATGACTAATTGGTTGCACAAC
Reverse Primer: A1073_R AACGGTTATGAACTTGGAGTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10032
1 x A11613
$36.00
Haplogroup Info
Other products
Currencies