Top » Catalog » SNPs » A1074

$18.00

A1074
[A1074]

A1074
hg38 Position: ChrY:17109589..17109589
Ancestral: G
Derived: A
Reference: Skip McDonald (2014)
ISOGG Haplogroup: R1b1a2a1a2c1b2 (not listed)
Comments: Approx. downstream from Z178513 and Z178515
Forward Primer: A1074_F CCTGGCAGCATAAATCCTTG
Reverse Primer: A1074_R CAAGGACATCACCTATAAGTTCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies