Top » Catalog » SNPs » A1105

$18.00

A1105
[A1105]

A1105
HG19 Position: ChrY:7986599..7986599
Ancestral: A
Derived: G
Reference: Mike Walsh (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream S1026
Forward Primer: A1105_F CTGGTGCAGCAATCATTCTC
Reverse Primer: A1105_R TTCATTGAATGTGGAGGTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies