Top » Catalog » SNPs » A1105

$18.00

A1105
[A1105]

A1105
HG19 Position: ChrY:7986599..7986599
Ancestral: A
Derived: G
Reference: Mike Walsh (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream S1026
Forward Primer: A1105_F CTGGTGCAGCAATCATTCTC
Reverse Primer: A1105_R TTCATTGAATGTGGAGGTTTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10134
1 x A10574
1 x A10388
1 x A10027
1 x A10514
1 x A11094
1 x A10523
1 x A10227
1 x A10023
1 x A11214
$180.00
Haplogroup Info
Other products
Currencies