Top » Catalog » SNPs » A1105

$18.00

A1105
[A1105]

A1105
hg38 Position: ChrY:7986599..7986599
Ancestral: A
Derived: G
Reference: Mike Walsh (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream S1026
Forward Primer: A1105_F CTGGTGCAGCAATCATTCTC
Reverse Primer: A1105_R TTCATTGAATGTGGAGGTTTTC
Reviews

Customers who bought this product also purchased
DF27
DF27
A1101
A1101
Z39589
Z39589
Z367
Z367
Z251
Z251
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies