Top » Catalog » SNPs » A1133

$18.00

A1133
[A1133]

A1133
hg38 Position: ChrY:17199439..17199443
Ancestral: ins
Derived: del
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a1a1
Comments: under S1121. L270.2
Forward Primer: A1133_F CTGAGTGGTATTGCACAGGG
Reverse Primer: A1133_R AAACATCCTCTCAGAATCACCC
Reviews

Customers who bought this product also purchased
A804
A804
A808
A808
S1126
S1126
A159
A159
A806
A806
Z16521
Z16521
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies