Top » Catalog » SNPs » A1133

$18.00

A1133
[A1133]

A1133
HG19 Position: ChrY:19311319..19311323
Ancestral: ins
Derived: del
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2a (not listed)
Comments: under S1121, L270.2
Forward Primer: A1133_F CTGAGTGGTATTGCACAGGG
Reverse Primer: A1133_R AAACATCCTCTCAGAATCACCC
Reviews

Customers who bought this product also purchased
A808
A808
A804
A804
A542
A542
Z17981
Z17981
S1126
S1126
A159
A159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies