Top » Catalog » SNPs » A1133

$18.00

A1133
[A1133]

A1133
HG19 Position: ChrY:19311319..19311323
Ancestral: ins
Derived: del
Reference: Nigel McCarthy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2a (not listed)
Comments: under S1121, L270.2
Forward Primer: A1133_F CTGAGTGGTATTGCACAGGG
Reverse Primer: A1133_R AAACATCCTCTCAGAATCACCC
Reviews

Customers who bought this product also purchased
A808
A808
A804
A804
FGC11150
FGC11150
A923
A923
R1b-FGC11134 Panel (including CTS4466)
R1b-FGC11134 Panel (including CTS4466)
A726
A726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies