Top » Catalog » SNPs » A1140

$17.50

A1140
[A1140]

A1140
HG19 Position: ChrY:17275463..17275463
Ancestral: C
Derived: T
Reference:
ISOGG Haplogroup: R1b (not listed)
Comments: Same position as PR2371
Forward Primer: A1140_F GTATGATTCAGAAACATCATTTCCC
Reverse Primer: A1140_R GTAGAGACAAGGTTTCGCTATGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies