Top » Catalog » SNPs » A1140

$18.00

A1140
[A1140]

A1140
HG19 Position: ChrY:15163583..15163583
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Same position as PR2371
Forward Primer: A1140_F GTATGATTCAGAAACATCATTTCCC
Reverse Primer: A1140_R GTAGAGACAAGGTTTCGCTATGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10994
1 x A10630
1 x A1166
1 x A10922
1 x A11615
1 x A10934
1 x A10617
1 x A1101
1 x A10964
1 x A11698
$180.00
Haplogroup Info
Other products
Currencies