Top » Catalog » SNPs » A1141

$18.00

A1141
[A1141]

A1141
hg38 Position: ChrY:20956076..20956076
Ancestral: A
Derived: G
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a (not listed)
Comments: Below S744
Forward Primer: A1141_F TTGTAAATTATCCATGGCTTTCTTC
Reverse Primer: A1141_R CAGGAATGCAGATAAACAGCAC
Reviews

Customers who bought this product also purchased
Y15478
Y15478
Y17075
Y17075
A9355
A9355
Y16859
Y16859
R1b-L1335 Scots Panel
R1b-L1335 Scots Panel
CTS4931
CTS4931
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies