Top » Catalog » SNPs » A1141

$18.00

A1141
[A1141]

A1141
HG19 Position: ChrY:23117962..23117962
Ancestral: A
Derived: G
Reference: Bjorn Lamborn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1a (not listed)
Comments: Below S744
Forward Primer: A1141_F TTGTAAATTATCCATGGCTTTCTTC
Reverse Primer: A1141_R CAGGAATGCAGATAAACAGCAC
Reviews

Customers who bought this product also purchased
A9355
A9355
Y15478
Y15478
Y17075
Y17075
Y16859
Y16859
S744
S744
F144
F144
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies