Top » Catalog » SNPs » A1142

$18.00

A1142
[A1142]

A1142
HG19 Position: ChrY:16392642..16392642
Ancestral: G
Derived: A
Reference:
ISOGG Haplogroup: R1b1a2a1a1c2b1b (not listed)
Comments: Below Z159 > FGC15332
Forward Primer: A1142_F GATGGTACCAATATTGCAATGG
Reverse Primer: A1142_R TCATTTCTTACCCAATGTACTCATTC
Reviews

Customers who bought this product also purchased
FGC15332
FGC15332
Z8
Z8
FGC15335
FGC15335
Z2
Z2
S3251
S3251
Z9
Z9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies