Top » Catalog » SNPs » A1142

$17.50

A1142
[A1142]

A1142
HG19 Position: ChrY:16392642..16392642
Ancestral: G
Derived: A
Reference:
ISOGG Haplogroup: R1b1a2a1a1c2b1b (not listed)
Comments: Below Z159 > FGC15332
Forward Primer: A1142_F GATGGTACCAATATTGCAATGG
Reverse Primer: A1142_R TCATTTCTTACCCAATGTACTCATTC
Reviews

Customers who bought this product also purchased
Z9
Z9
Z159
Z159
L47
L47
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
R1b-L48 Panel
R1b-L48 Panel
Z326
Z326
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies