Top » Catalog » SNPs » A1142

$18.00

A1142
[A1142]

A1142
HG19 Position: ChrY:14280762..14280762
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c2b1b2a
Comments: Below Z159 > FGC15332
Forward Primer: A1142_F GATGGTACCAATATTGCAATGG
Reverse Primer: A1142_R TCATTTCTTACCCAATGTACTCATTC
Reviews

Customers who bought this product also purchased
Z159
Z159
L47
L47
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
R1b-L48 Panel
R1b-L48 Panel
Z326
Z326
FGC15332
FGC15332
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11081
1 x A11520
1 x A11442
1 x A10286
1 x A11446
1 x A10708
$108.00
Haplogroup Info
Other products
Currencies