Top » Catalog » SNPs » A1144

$18.00

A1144
[A1144]

A1144
HG19 Position: ChrY:21065672..21065672
Ancestral: G
Derived: C
Reference:
ISOGG Haplogroup: I2c (not listed)
Comments: Below L596
Forward Primer: A1144_F GTAAATTTTGCACTCACATTGTGAC
Reverse Primer: A1144_R CATCCCCTTTTACCTTTCTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies