Top » Catalog » SNPs » A1147

$18.00

A1147
[A1147]

A1147
hg38 Position: ChrY:14071618..14071618
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC19846
Forward Primer: A1147_F TGTCACATGTTACCTCACCCTC
Reverse Primer: A1147_R CAGGGGCTTCAATATTAGAAATG
Reviews

Customers who bought this product also purchased
FGC19842
FGC19842
FGC19851
FGC19851
S673
S673
FGC12183
FGC12183
FGC30115
FGC30115
FGC35551
FGC35551
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10546
1 x A10388
1 x A11627
1 x A10405
$72.00
Haplogroup Info
Other products
Currencies