Top » Catalog » SNPs » A1148

$17.50

A1148
[A1148]

A1148
HG19 Position: ChrY:6734258..6734258
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: A1148_F CATCCCTGAAAGCAACTAAAGTG
Reverse Primer: A1148_R GAACCTGGCATGCAAGAATTAC
Reviews

Customers who bought this product also purchased
A1307
A1307
A1290
A1290
A1298
A1298
A1304
A1304
A1289
A1289
A1297
A1297
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies