Top » Catalog » SNPs » A1148

$18.00

A1148
[A1148]

A1148
HG19 Position: ChrY:6866217..6866217
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: A1148_F CATCCCTGAAAGCAACTAAAGTG
Reverse Primer: A1148_R GAACCTGGCATGCAAGAATTAC
Reviews

Customers who bought this product also purchased
R1b-FGC5494-z450611
R1b-FGC5494-z450611
A1292
A1292
A1301
A1301
DNA Sample Kit
DNA Sample Kit
A1308
A1308
A1291
A1291
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10866
1 x A11329
$36.00
Haplogroup Info
Other products
Currencies