Top » Catalog » SNPs » A1148

$18.00

A1148
[A1148]

A1148
hg38 Position: ChrY:6866217..6866217
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC5494
Forward Primer: A1148_F CATCCCTGAAAGCAACTAAAGTG
Reverse Primer: A1148_R GAACCTGGCATGCAAGAATTAC
Reviews

Customers who bought this product also purchased
A1149
A1149
A1293
A1293
A1302
A1302
R1b-FGC5494-z450611
R1b-FGC5494-z450611
A1292
A1292
A1301
A1301
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies