Top » Catalog » SNPs » A1150

$18.00

A1150
[A1150]

A1150
HG19 Position: ChrY:13431534..13431534
Ancestral: A
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1a (not listed)
Comments: Approx. L1498
Forward Primer: A1150_F AGAGAGAAATCCCAAACAGATCC
Reverse Primer: A1150_R TTTGTTTGAACCATTGCTGC
Reviews

Customers who bought this product also purchased
I2a-M423 Panel
I2a-M423 Panel
L1498
L1498
S2639
S2639
FGC7126
FGC7126
CTS10228
CTS10228
L161.1
L161.1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies