Top » Catalog » SNPs » A1150

$18.00

A1150
[A1150]

A1150
hg38 Position: ChrY:13431534..13431534
Ancestral: A
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1a (not listed)
Comments: Approx. L1498
Forward Primer: A1150_F AGAGAGAAATCCCAAACAGATCC
Reverse Primer: A1150_R TTTGTTTGAACCATTGCTGC
Reviews

Customers who bought this product also purchased
L1498
L1498
S2639
S2639
FGC7126
FGC7126
CTS10228
CTS10228
L161.1
L161.1
A813
A813
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies