Top » Catalog » SNPs » S2202

$18.00

S2202
[S2202]

S2202
hg38 Position: ChrY:14757949..14757949
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l3~
Comments: Downstream of FGC5496 and FGC5521
Forward Primer: S2202_F TGCTCTGTTACGCAGACTGG
Reverse Primer: S2202_R AGCAAAAGCTGGTGGAAATG
Reviews

Customers who bought this product also purchased
S1954
S1954
A376
A376
S1990
S1990
L338
L338
A1892
A1892
S1953
S1953
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies