Top » Catalog » SNPs » S781

$18.00

S781
[S781]

S781
hg38 Position: ChrY:16426590..16426590
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i1a1
Comments: Found in Stewart study
Forward Primer: S781_F TCCAAAATCAGCACTGAAGG
Reverse Primer: S781_R AGGGAAGAAGGAGAGAAATGG
Reviews (1)

Customers who bought this product also purchased
Z17581
Z17581
DF41
DF41
A749
A749
Y14197
Y14197
Z17582
Z17582
A5023
A5023
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies