Top » Catalog » SNPs » S781

$18.00

S781
[S781]

S781
HG19 Position: ChrY:16426590..16426590
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i1a1
Comments: Found in Stewart study
Forward Primer: S781_F TCCAAAATCAGCACTGAAGG
Reverse Primer: S781_R AGGGAAGAAGGAGAGAAATGG
Reviews (1)

Customers who bought this product also purchased
A5023
A5023
S310
S310
Y14198
Y14198
A889
A889
MC21
MC21
A306
A306
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies