Top » Catalog » SNPs » A1151

$18.00

A1151
[A1151]

A1151
HG19 Position: ChrY:10116643..10116643
Ancestral: G
Derived: A
Reference: Hamma Bachir (2014)
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Below M183
Forward Primer: A1151_F CTAGTCATGTGGCTGAACTCG
Reverse Primer: A1151_R CACATGGAAGCTACCAAGGTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10324
$18.00
Haplogroup Info
Other products
Currencies