Top » Catalog » SNPs » A1152

$18.00

A1152
[A1152]

A1152
hg38 Position: ChrY:16719215..16719215
Ancestral: C
Derived: T
Reference: Hamma Bachir (2014)
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Below M183
Forward Primer: A1152_F TTCCATGTTTGCCAAGGG
Reverse Primer: A1152_R GGCAAAGGAGAGTAGCTGGC
Reviews

Customers who bought this product also purchased
BY9709
BY9709
Y20079
Y20079
M168
M168
L901
L901
V13
V13
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies