Top » Catalog » SNPs » A1152

$17.50

A1152
[A1152]

A1152
HG19 Position: ChrY:18831095..18831095
Ancestral: C
Derived: T
Reference: Hamma Bachir (2014)
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Below M183
Forward Primer: A1152_F TTCCATGTTTGCCAAGGG
Reverse Primer: A1152_R GGCAAAGGAGAGTAGCTGGC
Reviews

Customers who bought this product also purchased
MZ90
MZ90
PF6794
PF6794
MZ136
MZ136
A929
A929
MZ131
MZ131
M81
M81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10541
1 x A10369
1 x A109
1 x A10298
1 x A100
1 x A1074
1 x A10300
1 x A10312
1 x A10930
1 x A11768
1 x A11673
1 x A10953
1 x A11512
1 x A1036
1 x A10542
1 x A10152
1 x A11187
1 x A1165
1 x A11371
1 x A10636
1 x A11224
1 x A10287
1 x A1177
1 x A11116
1 x A1025
1 x A11309
1 x A11510
1 x A11041
1 x A10556
1 x A11531
1 x A11487
1 x A10510
1 x A11795
1 x A10022
1 x A10565
1 x A11003
1 x A1142
1 x A10708
1 x A10809
1 x A10260
1 x A11372
1 x A1101
1 x A1045
1 x A11381
1 x A10030
1 x A10982
1 x A10512
1 x A11689
1 x A11367
1 x A10912
1 x A1133
1 x A11221
1 x A11096
1 x A11635
1 x A10964
1 x A11655
1 x A10579
1 x A10762
1 x A10222
1 x A10537
1 x A10652
1 x A11601
1 x A10246
1 x A11695
1 x A10523
1 x A10023
1 x A11214
1 x A11076
1 x A11308
1 x A1081
1 x A11680
1 x A10219
1 x A10324
$1,277.50
Haplogroup Info
Other products
Currencies