Top » Catalog » SNPs » A1154

$18.00

A1154
[A1154]

A1154
HG19 Position: ChrY:15663612..15663612
Ancestral: T
Derived: C
Reference: Paul Beatty (2014)
ISOGG Haplogroup: R1b (not listed)
Comments:
Forward Primer: A1154_F GCCTACAGCTGCACAGATAGAATAG
Reverse Primer: A1154_R AGAGAAGGATGGTTCTTACTCTGC
Reviews

Customers who bought this product also purchased
A476
A476
A430
A430
Z16433
Z16433
R1b-Z255 Panel
R1b-Z255 Panel
A816
A816
A1247
A1247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies