Top » Catalog » SNPs » A1154

$18.00

A1154
[A1154]

A1154
HG19 Position: ChrY:13551732..13551732
Ancestral: T
Derived: C
Reference: Paul Beatty (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A1154v2_F CCAGTAGGTTCCAGTGGGTG
Reverse Primer: A1154v2_R CATGTTGGCCAGGACAGG
Reviews

Customers who bought this product also purchased
Z16433
Z16433
R1b-Z255 Panel
R1b-Z255 Panel
A816
A816
A1247
A1247
A476
A476
A430
A430
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies