Top » Catalog » SNPs » A1155

$18.00

A1155
[A1155]

A1155
HG19 Position: ChrY:14950507..14950507
Ancestral: A
Derived: G
Reference:
ISOGG Haplogroup: R1b1a2a1a1c2b3 (not listed)
Comments: Likely downstream of L200 and S21607
Forward Primer: A1155_F ACGGAGTCTTGCACTGTCATC
Reverse Primer: A1155_R AGGGGTTTTGAAGGTCAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies