Top » Catalog » SNPs » A1156

$18.00

A1156
[A1156]

A1156
HG19 Position: ChrY:23134874..23134874
Ancestral: G
Derived: A
Reference: Wayne Parrott (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: .
Forward Primer: A1156_F TTGGGCTTGTATTTTAGACTGG
Reverse Primer: A1156_R GGCTATGGGCCTTTTTCC
Reviews

Customers who bought this product also purchased
FGC13288
FGC13288
Wish a SNP
Wish a SNP
FGC13292
FGC13292
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies