Top » Catalog » SNPs » A1158

$18.00

A1158
[A1158]

A1158
HG19 Position: ChrY:18970339..18970339
Ancestral: G
Derived: A
Reference: Peter Gwozdz (2014)
ISOGG Haplogroup: E1b (not listed)
Comments: Approx. L540
Forward Primer: A1158_F GCAGTGGCACGTTCTCATG
Reverse Primer: A1158_R AAGAGTGGAGGCAAGACAGC
Reviews

Customers who bought this product also purchased
A1157
A1157
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A10884
$18.00
Haplogroup Info
Other products
Currencies