Top » Catalog » SNPs » A1157

$18.00

A1157
[A1157]

A1157
HG19 Position: ChrY:20819574..20819574
Ancestral: G
Derived: T
Reference: Peter Gwozdz (2014)
ISOGG Haplogroup: E1b (not listed)
Comments: Approx. L540
Forward Primer: A1157_F GAAAATGCCTTAACAAGATGAGC
Reverse Primer: A1157_R TTCTAATAATTTGTGGGCTCGG
Reviews

Customers who bought this product also purchased
A1158
A1158
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies