Top » Catalog » SNPs » A1159

$18.00

A1159
[A1159]

A1159
HG19 Position: ChrY:11958109..11958109
Ancestral: G
Derived: C
Reference: David R Moore (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1c (not loisted)
Comments: Below L1402
Forward Primer: A1159_F CGATGTGGTGTGCCAGGT
Reverse Primer: A1159_R CACTGTCAATAGGGAAGTTTCCTC
Reviews

Customers who bought this product also purchased
L1402
L1402
A459
A459
A1160
A1160
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11677
$18.00
Haplogroup Info
Other products
Currencies